Skip to main content

Table 1 Primer sequences, PCR conditions and restriction enzymes used for mutation analysis and genotyping of selected polymorphisms in the TOLLIP gene.

From: Association of toll-interacting protein gene polymorphisms with atopic dermatitis

Amplicon Rs number Amino acid Primer Annealing temperature MgCl2 (mmol/l) Restriction enzyme
TOLLIP-526 C/G 5743854 - F: GGGTGACCTTCGGACGTG
R: CATCTTTAGCCCTGTGAAACAG
57°C 2 Hin6I
TOLLIP exon 1* - - F: GACAACTGTCTCCGTCGCA
R: TGGGTCAGGGCTACTGCT
55°C 2 -
TOLLIP intron1a 5743867 - F: ACTCTCCCAGCACCTGACGCTTAAG
R: ACCAGCGCTACCAACTGTGGCGAT
61°C 4 MboI
TOLLIP intron1b 11042484 - F: GACCCAGCCGTCTGCAGGG
R: TCCATGGCACAGGCAGGTACG
62°C 2 Hin6I
TOLLIP exon 2* - - F: ACCCTGACTCACTGGCCTC
R: TTTCAACATCACACAGGTTTCA
58°C 2 -
TOLLIP exon 3* - - F: GTTGGCACCTCCTTTTCCTGAC
R: CAGGTGTGTCCCCACGGC
66°C 2 -
TOLLIP exon 4 3750920 Pro139Pro F: GGGCCTCTCCCTCTTGTC
R: TCAGAACGTGAGCCCTGC
60°C 3 MspI
TOLLIP exon 5* - - F: GGTTCTGATGGGTGGATGTTCC
R: ACCTGCCCTAGGCCCTGG
66°C 2 -
TOLLIP exon 6 5744015 Ala222Ser F: TTCCGACGTTTTTACCAAACTTGAT
R: GCGTGTCCAAAGAGCGGG
63°C 2 MwoI
TOLLIP 3'UTR 3750919 - F: AGCCTGACTCTCACACTCAGCA
R: GGGAGCAAAACCTTGATACCAA
58°C 3 Alw26I
  1. F = forward primer, R = reverse primer,
  2. *Amplicons were only amplified for SSCP analysis; no coding variation was discovered with this method